From Wikipedia, the free encyclopedia
In human genetics, Haplogroup I1a (M253, M307, P30, P40) is a Y-chromosome haplogroup occurring at greatest frequency in Scandinavia. It displays a very clear frequency gradient, with a peak frequency of approximately 35% among the populations of southern Norway, southwestern Sweden, and Denmark, and rapidly decreasing frequencies toward the edges of the historically Germanic-influenced world. Bryan Sykes in his book Blood of the Isles & his other book Saxons, Vikings & Celts gives the populations associated with I1a the name of the nordic deity Wodan for a clan patriarch, much as he did for mitochondrial haplogroups in his work The Seven Daughters of Eve.
Outside Fennoscandia, distribution of Haplogroup I1a is closely correlated with that of Haplogroup I1b2; but among Scandinavians (including both Germanic and Uralic peoples of the region) nearly all the Haplogroup I Y-chromosomes are I1a. Another characteristic of the Scandinavian I1a Y-chromosomes is their rather low haplotype diversity (STR diversity): a greater variety of Haplogroup I1a Y-chromosomes has been found among the French and Italians, despite the much lower overall frequency of Haplogroup I1a among the modern French and Italian populations. It is conjectured that this shared ancestral population of I1a and I2b, distinct from I1b1*, may have weathered the last ice age in a refuge located somewhere in the Iberian Peninsula or southern France, or perhaps the Italian Peninsula; after the end of the ice age, some of them headed northward and repopulated Northwest Europe and Scandinavia. This population appears to have carried haplogroups I1a and I1b2 at significant frequencies, with a numerical superiority of Haplogroup I1a. Their descendants are primarily found among the Germanic populations of Northern Europe and the bordering Uralic and Celtic populations. Although even in traditionally Germanic demographics, the carriers of I1a are often overshadowed by the more prevalent carriers of Haplogroup R.
[edit] Modal haplotypes of I1a
Professor Ken Nordtvedt has given the following 'Modal Haplotypes' within the I1a haplogroup according to examples found in I1a populations. [1]
I1a Anglo-Saxon (I1a-AS) Has its peak gradient in the Germanic lowland countries: north Germany, Denmark, the Netherlands, as well as the British Isles & old Norman regions of France.
DYS number |
385a |
385b |
388 |
389i |
389ii |
390 |
391 |
392 |
393 |
426 |
437 |
439 |
447 |
448 |
449 |
454 |
455 |
458 |
459a |
459b |
Haplotype |
13 |
14 |
14 |
12 |
28 |
22 |
10 |
11 |
13 |
11 |
16 |
11 |
23 |
20 |
28 |
11 |
8 |
15 |
8 |
9 |
DYS number |
425 |
438 |
441 |
442 |
444 |
445 |
446 |
452 |
456 |
460 |
461 |
462 |
463 |
464a |
464b |
464c |
464d |
570 |
576 |
607 |
CDYa |
CDYb |
YCAIIa |
YCAIIb |
Haplotype |
12 |
10 |
16 |
12 |
13 |
11 |
13 |
12 |
14 |
10 |
12 |
12 |
19 |
12 |
14 |
15 |
16 |
— |
— |
14 |
— |
— |
19 |
21 |
I1a Norse (I1a-N) Has its peak gradient in Sweden.
DYS number |
385a |
385b |
388 |
389i |
389ii |
390 |
391 |
392 |
393 |
426 |
437 |
439 |
447 |
448 |
449 |
454 |
455 |
458 |
459a |
459b |
Haplotype |
14 |
14 |
14 |
12 |
28 |
23 |
10 |
11 |
13 |
11 |
16 |
11 |
23 |
20 |
28 |
11 |
8 |
15 |
8 |
9 |
DYS number |
425 |
438 |
441 |
442 |
444 |
445 |
446 |
452 |
456 |
460 |
461 |
462 |
463 |
464a |
464b |
464c |
464d |
570 |
576 |
607 |
CDYa |
CDYb |
YCAIIa |
YCAIIb |
Haplotype |
12 |
10 |
16 |
12 |
13 |
11 |
13 |
12 |
14 |
10 |
12 |
13 |
19 |
12 |
14 |
15 |
16 |
— |
— |
14 |
— |
— |
19 |
21 |
I1a Norse-Bothnia (I1a-N-Finn) Has its peak gradient in Finland.
DYS number |
385a |
385b |
388 |
389i |
389ii |
390 |
391 |
392 |
393 |
426 |
437 |
439 |
447 |
448 |
449 |
454 |
455 |
458 |
459a |
459b |
Haplotype |
14 |
14 |
14 |
12 |
28 |
23 |
10 |
11 |
13 |
11 |
16 |
10 |
23 |
20 |
28;29 |
11 |
8 |
15 |
8 |
9 |
DYS number |
425 |
438 |
441 |
442 |
444 |
445 |
446 |
452 |
456 |
460 |
461 |
462 |
463 |
464a |
464b |
464c |
464d |
570 |
576 |
607 |
CDYa |
CDYb |
YCAIIa |
YCAIIb |
Haplotype |
12 |
10 |
16 |
12 |
13 |
11 |
13 |
12 |
14 |
10 |
12 |
13 |
19 |
12 |
14 |
15 |
15 |
— |
— |
14 |
— |
— |
19 |
21 |
I1a Ultra-Norse Type 1 (I1a-uN1) Has its peak gradient in Norway.
DYS number |
385a |
385b |
388 |
389i |
389ii |
390 |
391 |
392 |
393 |
426 |
437 |
439 |
447 |
448 |
449 |
454 |
455 |
458 |
459a |
459b |
Haplotype |
14 |
15 |
14 |
12 |
28 |
23 |
10 |
11 |
13 |
11 |
16 |
11 |
23 |
20 |
28;29 |
11 |
8 |
15 |
8 |
9 |
DYS number |
425 |
438 |
441 |
442 |
444 |
445 |
446 |
452 |
456 |
460 |
461 |
462 |
463 |
464a |
464b |
464c |
464d |
570 |
576 |
607 |
CDYa |
CDYb |
YCAIIa |
YCAIIb |
Haplotype |
12 |
10 |
16 |
12 |
13 |
11 |
13 |
12 |
14 |
10 |
12 |
13 |
19 |
12 |
14 |
15 |
16 |
— |
— |
14 |
— |
— |
19 |
21 |
[edit] Technical specification of mutation
The technical details of M253 are:
- Nucleotide change: C to T
- Position (base pair): 283
- Total size (base pairs): 400
- Forward 5′→ 3′: gcaacaatgagggtttttttg
- Reverse 5′→ 3′: cagctccacctctatgcagttt
[edit] Subclades
- I1a (M253, M307, P30, P40, S62, S63, S64, S65, S66)
- I1a*
- I1a1 (M227) formerly I1a4
- I1a2 (M21)
- I1a3 (M72)
[edit] See also
[edit] External links