New Immissions/Updates:
boundless - educate - edutalab - empatico - es-ebooks - es16 - fr16 - fsfiles - hesperian - solidaria - wikipediaforschools
- wikipediaforschoolses - wikipediaforschoolsfr - wikipediaforschoolspt - worldmap -

See also: Liber Liber - Libro Parlato - Liber Musica  - Manuzio -  Liber Liber ISO Files - Alphabetical Order - Multivolume ZIP Complete Archive - PDF Files - OGG Music Files -

PROJECT GUTENBERG HTML: Volume I - Volume II - Volume III - Volume IV - Volume V - Volume VI - Volume VII - Volume VIII - Volume IX

Ascolta ""Volevo solo fare un audiolibro"" su Spreaker.
CLASSICISTRANIERI HOME PAGE - YOUTUBE CHANNEL
Privacy Policy Cookie Policy Terms and Conditions
Haplogroup R1b (Y-DNA) - Wikipedia, the free encyclopedia

Haplogroup R1b (Y-DNA)

From Wikipedia, the free encyclopedia

Distribution of R1a (purple) and R1b (red)
Distribution of R1a (purple) and R1b (red)

In human genetics, Haplogroup R1b (M343) (previously called Hg1 and Eu18) is the most frequent Y-chromosome haplogroup in Europe.

Its frequency is highest in Western Europe, especially in Atlantic Europe (and due to European emigration, in North America, South America, and Australia). In southern England, the frequency of R1b is about 70%, and in parts of Spain, Portugal, France, Wales, and Ireland, the frequency of R1b is greater than 90%. Bryan Sykes in his book Blood of the Isles gives the populations associated with R1b the name of Oisín for a clan patriarch, much as he did for mitochondrial haplogroups in his work The Seven Daughters of Eve.

Contents

[edit] Subclades

Haplogroup R1b is a descendant of Haplogroup R1 (M173). R1b is characterised by the presence of the M343 marker.

  • R1b (M343)
    • R1b*
    • R1b1 (P25)
      • R1b1*
      • R1b1a (M18)
      • R1b1b (M73)
      • R1b1c (M269, S3, S10, S13, S17)
        • R1b1c*
        • R1b1c1 (M37)
        • R1b1c2 (M65)
        • R1b1c3 (M126)
        • R1b1c4 (M153)
        • R1b1c5 (M160)
        • R1b1c6 (SRY2627 (M167))
        • R1b1c7 (M222)
        • R1b1c8 (P66)
        • R1b1c9 (S21)
          • R1b1c9*
          • R1b1c9a (S26)
          • R1b1c9b (S29)
        • R1b1c10 (S28)
      • R1b1d (M335)

[edit] R1b1c

Nearly all present-day Europeans with the M343 marker also have the P25 and M269 markers. These markers define the R1b1c subclade.

This subgroup probably originated in Central Asia/South Central Siberia and appears to have entered prehistoric Europe mainly from the area of Ukraine/Belarus or Central Asia (Kazakhstan) via the coasts of the Black Sea and the Baltic Sea. It is believed by some to have been widespread in Europe before the last Ice Age, and associated with the Aurignacian culture (32,000 - 21,000 BC) of the Cro-Magnon people, the first modern humans to enter Europe. The Cro-Magnons were the first documented human artists, making sophisticated cave paintings. Famous sites include Lascaux in France, Cueva de las Monedas in Spain and Valley of Foz Côa in Portugal (the largest open-air site in Europe).

European LGM refuges, 20 kya.
European LGM refuges, 20 kya.

The glaciation of the ice age intensified, and the continent became increasingly uninhabitable. The genetic diversity narrowed through founder effects and population bottlenecks, as the population became limited to a few coastal refugia in Southern Europe and Asia Minor. The present-day population of R1b in Western Europe are believed to be the descendants of a refugium in the Iberian peninsula (Portugal and Spain), where the R1b1c haplogroup may have achieved genetic homogeneity. As conditions eased with the Allerød Oscillation in about 12,000 BC, descendants of this group migrated and eventually recolonised all of Western Europe, leading to the dominant position of R1b in variant degrees from Iberia to Scandinavia, so evident in haplogroup maps.

An alternative belief is that R1b represents the Western or centum-speaking branch of the Proto-Indo-Europeans, although this too remains uncertain.

A second R1b1c population, reflected in a somewhat different distribution of haplotypes of the more rapidly varying Y-STR markers, appear to have survived alongside other haplogroups in Asia Minor, from where they spread out to repopulate Eastern Europe. However, they do not have the same dominance that R1b has in Western Europe. Instead the most common haplogroup in Eastern Europe is haplogroup R1a1, often thought to be associated with a subsequent migration of Indo-Europeans (or perhaps their ancestors) from the East.

Note that haplogroup R1b and haplogroup R1a first existed at very different times. The mutations that characterize haplogroup R1b occurred ~30,000 years bp, whereas the mutations that characterize haplogroup R1a occurred ~10,000 years bp.

(Note that in earlier literature the M269 marker, rather than M343, was used to define the R1b haplogroup. Then, for a time (from 2003 to 2005) what is now R1b1c was designated R1b3. This shows how nomenclature can evolve as new markers are discovered and then investigated).

The subclades R1b1c4 (M153) and R1b1c6 (SRY2627 (M167)) have been found to be typical of the Basque people; these subclades are only rarely found among Spaniards from other parts of Spain and are found sporadically among other European populations, which at one time was though to indicate some sort of founder effect or genetic drift among a rather genetically isolated population of proto-Basques. Commercial testing has showm M167 to occur in Southwest England and Ireland, and to a lesser extent in Scotland. This haplogroup has also been reported from France (although a sampling bias may be at "fault" since relatively few French samples have been tested), and as far east as Germany. One problem that is critical to the understanding of the origin of R1b in Europe but which has been overlooked by popularizers of various theories is that the R1b frequency peak found in the Basque Country, Pyrenees, and southwestern France actually overlaps a zone of extremely decreased diversity of R1b-associated STR haplotypes.

The subclade R1b1c7 (M222), on the other hand, is associated with the Irish and Scots; in this case, the relatively high frequency of this specific subclade among the population of certain counties in northwestern Ireland may be due to positive social selection, as R1b1c7-M222 is believed to have been the Y-chromosome haplogroup of the kings of the Uí Néill clan of ancient Ireland.

The R1b1c9 (S21) subclade, although recently discovered by EthnoAncestry, appears to be the most common downstream marker from R1b1c appearing in over 35% of those tested. It appears that this group has a maximum in Northern Germany and is the predominant R1b haplogroup in Scandinavia. [1] The exact technical definition of the SNP was not initially released for commercial reasons, but the same marker was subsequently independently identified (as their "U106") by Sims et al (2007) [2].

The R1b1c9a subclade is defined by the S26 SNP, and occurs in less than a half a percent of R1b males. S26 is located in the flanking region of DYS439. When it occurs, it inhibits the FTDNA primers from binding, thus producing an apparent null allele or "null 439". For further information, see [3]. The other marker downstream from S21 is S29 which defines R1b1c9b, which was also discovered by EthnoAncestry, and has to date been found primarily in England (although this may reflect a sampling bias). Recent findings show that it also occurs in Germany in the region previously inhabited by the Saxons. Further studies will serve to ascertain whether this is a native Briton marker, or Continenetal and having arrived in England with the Anglo - Saxons in the 5th Century.

The R1b1c10 (S28) subclade's discovery was announced in 2005 by EthnoAncestry. Although sample sizes are relatively small, it appears to reach a maximum in Alpine Germany and Switzerland. Ethnoancestry's commercial and research branches have shown that S28 is found from Greece westward to the Bay of Biscay in France. It appears to follow the distribution of the La Tene Celtic peoples. One branch appears to have moved north to Jutland (as the Cimbri / Charudes nation / tribe) and southeastern Norway possibly during the Bronze Age. To date all findings in Britain are only from locations known to be settled by the Norse (e.g., Orkney) and Danes (e.g., English Danelaw) probably during Viking times. The percentages here are much less than found in the Alps. It has yet to be found anywhere in Ireland or Spain. Northern Italy seems to be a meeting place for both S21 and S28. Like S21, S28's specifications were not initially officially published by EthnoAncestry; but again the marker was subsequently identified independently (as their "U152") by Sims et al (2007). [4]

EthnoAncestry has embarked on a research program to systematically study the distribution of R1b1c9 and R1b1c10 across Europe. For example, preliminary work with samples from Norway and Friesland (Holland) is complete; and ongoing work includes large samples from Italy and Spain.

[edit] Other subclades

Populations characterised as R1b1a (M18) and R1b1b (M73) with those mutually exclusive distinctive markers but no M269 have been found, in Sardinia, and in central Asia, respectively. It is presumed that these are descendants of R1b1 populations which found other refuges from the ice.

An apparent R1b1* population has been found among the Ouldeme of Northern Cameroon in west central Africa. [5] [6]

[edit] Modal haplotypes

Within the R1b haplogroup are modal haplotypes. One of the best-characterized of these haplotypes is the Atlantic Modal Haplotype (AMH). This haplotype reaches the highest frequencies in the Iberian Peninsula and in the British Isles. In the Iberian Peninsula it reaches 33% in Portugal.

There also exists a haplotype of R1b with the DYS393=12 which is known in the literature as Haplotype 35, or ht35, as opposed to the AMH which is known as haplotype 15. The members of this haplotype are thought to be descended from early R1b's who found shelter in Anatolia during the Last Glacial Maximum instead of in Iberia. They can be found in high numbers in Anatolia and Armenia with smaller numbers throughout the Middle East, in Jewish populations, in Southeastern Europe, and in the Caucasus Mountains. There is also a sizable pocket of ht35 in Uyghur populations in western China, which is thought to be a remnant of the Tocharians, an Indo-European speaking people that inhabited the Tarim Basin in Central Asia until they were later absorbed by various Turkic peoples. Ht35 is also present in Britain in areas that were found to have a high concentration of Haplogroup J, suggesting they arrived together, perhaps through Roman soldiers. For further information and different subgroups of ht35, see [7] .

[edit] Niall of the Nine Hostages

In 2006, a subgroup of R1b common among people of Irish patrilineal descent was identified as the probable haplotype of many within the septs associated with Niall of the Nine Hostages, an Irish king in the Dark Ages. SNP testing has shown that the cluster of haplotypes purported to be associated with the patrilineal descendants of the Uí Néill clan displays the M222 mutation that defines Haplogroup R1b1c7.

[edit] Relationship to other haplogroups

Human Y-chromosome DNA (Y-DNA) haplogroups

Y-most recent common ancestor
|
A |
B |
C DE F
D E G H IJ K
I J L M NO P
N O Q R
Haplogroup R
Haplogroup R1
Haplogroup R1a

Haplogroup R1a1




Haplogroup R1b




Haplogroup R2




[edit] Technical specification of mutation

The technical details of M343 are:

Nucleotide change: C to A
Position (base pair): 402
Total size (base pairs): 424
Forward 5′→ 3′: tttaacctcctccagctctgca
Reverse 5′→ 3′: acccccacatatctccagg

This refers to a particular 424 base pair fragment of DNA that the polymerase chain reaction produces when one uses the two "primer" strands listed.

[edit] See also

[edit] References

[edit] External links

Static Wikipedia (no images)

aa - ab - af - ak - als - am - an - ang - ar - arc - as - ast - av - ay - az - ba - bar - bat_smg - bcl - be - be_x_old - bg - bh - bi - bm - bn - bo - bpy - br - bs - bug - bxr - ca - cbk_zam - cdo - ce - ceb - ch - cho - chr - chy - co - cr - crh - cs - csb - cu - cv - cy - da - de - diq - dsb - dv - dz - ee - el - eml - en - eo - es - et - eu - ext - fa - ff - fi - fiu_vro - fj - fo - fr - frp - fur - fy - ga - gan - gd - gl - glk - gn - got - gu - gv - ha - hak - haw - he - hi - hif - ho - hr - hsb - ht - hu - hy - hz - ia - id - ie - ig - ii - ik - ilo - io - is - it - iu - ja - jbo - jv - ka - kaa - kab - kg - ki - kj - kk - kl - km - kn - ko - kr - ks - ksh - ku - kv - kw - ky - la - lad - lb - lbe - lg - li - lij - lmo - ln - lo - lt - lv - map_bms - mdf - mg - mh - mi - mk - ml - mn - mo - mr - mt - mus - my - myv - mzn - na - nah - nap - nds - nds_nl - ne - new - ng - nl - nn - no - nov - nrm - nv - ny - oc - om - or - os - pa - pag - pam - pap - pdc - pi - pih - pl - pms - ps - pt - qu - quality - rm - rmy - rn - ro - roa_rup - roa_tara - ru - rw - sa - sah - sc - scn - sco - sd - se - sg - sh - si - simple - sk - sl - sm - sn - so - sr - srn - ss - st - stq - su - sv - sw - szl - ta - te - tet - tg - th - ti - tk - tl - tlh - tn - to - tpi - tr - ts - tt - tum - tw - ty - udm - ug - uk - ur - uz - ve - vec - vi - vls - vo - wa - war - wo - wuu - xal - xh - yi - yo - za - zea - zh - zh_classical - zh_min_nan - zh_yue - zu -

Static Wikipedia 2007 (no images)

aa - ab - af - ak - als - am - an - ang - ar - arc - as - ast - av - ay - az - ba - bar - bat_smg - bcl - be - be_x_old - bg - bh - bi - bm - bn - bo - bpy - br - bs - bug - bxr - ca - cbk_zam - cdo - ce - ceb - ch - cho - chr - chy - co - cr - crh - cs - csb - cu - cv - cy - da - de - diq - dsb - dv - dz - ee - el - eml - en - eo - es - et - eu - ext - fa - ff - fi - fiu_vro - fj - fo - fr - frp - fur - fy - ga - gan - gd - gl - glk - gn - got - gu - gv - ha - hak - haw - he - hi - hif - ho - hr - hsb - ht - hu - hy - hz - ia - id - ie - ig - ii - ik - ilo - io - is - it - iu - ja - jbo - jv - ka - kaa - kab - kg - ki - kj - kk - kl - km - kn - ko - kr - ks - ksh - ku - kv - kw - ky - la - lad - lb - lbe - lg - li - lij - lmo - ln - lo - lt - lv - map_bms - mdf - mg - mh - mi - mk - ml - mn - mo - mr - mt - mus - my - myv - mzn - na - nah - nap - nds - nds_nl - ne - new - ng - nl - nn - no - nov - nrm - nv - ny - oc - om - or - os - pa - pag - pam - pap - pdc - pi - pih - pl - pms - ps - pt - qu - quality - rm - rmy - rn - ro - roa_rup - roa_tara - ru - rw - sa - sah - sc - scn - sco - sd - se - sg - sh - si - simple - sk - sl - sm - sn - so - sr - srn - ss - st - stq - su - sv - sw - szl - ta - te - tet - tg - th - ti - tk - tl - tlh - tn - to - tpi - tr - ts - tt - tum - tw - ty - udm - ug - uk - ur - uz - ve - vec - vi - vls - vo - wa - war - wo - wuu - xal - xh - yi - yo - za - zea - zh - zh_classical - zh_min_nan - zh_yue - zu -

Static Wikipedia 2006 (no images)

aa - ab - af - ak - als - am - an - ang - ar - arc - as - ast - av - ay - az - ba - bar - bat_smg - bcl - be - be_x_old - bg - bh - bi - bm - bn - bo - bpy - br - bs - bug - bxr - ca - cbk_zam - cdo - ce - ceb - ch - cho - chr - chy - co - cr - crh - cs - csb - cu - cv - cy - da - de - diq - dsb - dv - dz - ee - el - eml - eo - es - et - eu - ext - fa - ff - fi - fiu_vro - fj - fo - fr - frp - fur - fy - ga - gan - gd - gl - glk - gn - got - gu - gv - ha - hak - haw - he - hi - hif - ho - hr - hsb - ht - hu - hy - hz - ia - id - ie - ig - ii - ik - ilo - io - is - it - iu - ja - jbo - jv - ka - kaa - kab - kg - ki - kj - kk - kl - km - kn - ko - kr - ks - ksh - ku - kv - kw - ky - la - lad - lb - lbe - lg - li - lij - lmo - ln - lo - lt - lv - map_bms - mdf - mg - mh - mi - mk - ml - mn - mo - mr - mt - mus - my - myv - mzn - na - nah - nap - nds - nds_nl - ne - new - ng - nl - nn - no - nov - nrm - nv - ny - oc - om - or - os - pa - pag - pam - pap - pdc - pi - pih - pl - pms - ps - pt - qu - quality - rm - rmy - rn - ro - roa_rup - roa_tara - ru - rw - sa - sah - sc - scn - sco - sd - se - sg - sh - si - simple - sk - sl - sm - sn - so - sr - srn - ss - st - stq - su - sv - sw - szl - ta - te - tet - tg - th - ti - tk - tl - tlh - tn - to - tpi - tr - ts - tt - tum - tw - ty - udm - ug - uk - ur - uz - ve - vec - vi - vls - vo - wa - war - wo - wuu - xal - xh - yi - yo - za - zea - zh - zh_classical - zh_min_nan - zh_yue - zu

Static Wikipedia February 2008 (no images)

aa - ab - af - ak - als - am - an - ang - ar - arc - as - ast - av - ay - az - ba - bar - bat_smg - bcl - be - be_x_old - bg - bh - bi - bm - bn - bo - bpy - br - bs - bug - bxr - ca - cbk_zam - cdo - ce - ceb - ch - cho - chr - chy - co - cr - crh - cs - csb - cu - cv - cy - da - de - diq - dsb - dv - dz - ee - el - eml - en - eo - es - et - eu - ext - fa - ff - fi - fiu_vro - fj - fo - fr - frp - fur - fy - ga - gan - gd - gl - glk - gn - got - gu - gv - ha - hak - haw - he - hi - hif - ho - hr - hsb - ht - hu - hy - hz - ia - id - ie - ig - ii - ik - ilo - io - is - it - iu - ja - jbo - jv - ka - kaa - kab - kg - ki - kj - kk - kl - km - kn - ko - kr - ks - ksh - ku - kv - kw - ky - la - lad - lb - lbe - lg - li - lij - lmo - ln - lo - lt - lv - map_bms - mdf - mg - mh - mi - mk - ml - mn - mo - mr - mt - mus - my - myv - mzn - na - nah - nap - nds - nds_nl - ne - new - ng - nl - nn - no - nov - nrm - nv - ny - oc - om - or - os - pa - pag - pam - pap - pdc - pi - pih - pl - pms - ps - pt - qu - quality - rm - rmy - rn - ro - roa_rup - roa_tara - ru - rw - sa - sah - sc - scn - sco - sd - se - sg - sh - si - simple - sk - sl - sm - sn - so - sr - srn - ss - st - stq - su - sv - sw - szl - ta - te - tet - tg - th - ti - tk - tl - tlh - tn - to - tpi - tr - ts - tt - tum - tw - ty - udm - ug - uk - ur - uz - ve - vec - vi - vls - vo - wa - war - wo - wuu - xal - xh - yi - yo - za - zea - zh - zh_classical - zh_min_nan - zh_yue - zu